brunello whole genome library  (Addgene inc)

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Genome-wide CRISPR screening reveals a PKA-driven resistance mechanism to metformin for oral cancer prevention that can be exploited by combination with NSAIDs

doi: 10.1158/1940-6207.CAPR-25-0264

Figure Lengend Snippet: (A) Schema of genome-wide CRISPR screen experimental design. Cartoon created with BioRender. (B) Table of genes encoding for AMPK subunits. (C) Top 20 normalized enrichment scores from pre-ranked GSEA run on beta-score-ranked genes in the Reactome Pathways obtained from MSigDB (left). Reactome Pathways with gene sets related to PKA signaling are bolded for emphasis (left). Table of genes encoding the regulatory subunits of PKA (right). (D) Western blot for Cal27 cells treated with metformin for 24 hours at the indicated doses. Total and phosphorylated CREB are shown, in addition to the phosphorylation status of the PKA substrate motif RRXS*/T* (PKA substrates). HSP90 was used as a loading control (left). Representative immunoblots are shown from n = 3 independent experiments. Quantification of p-CREB signal normalized to total CREB levels and p-PKA substrates normalized to control signal (right). Data are shown as mean ± SEM, n = 3. Statistical analysis was performed using one-way ANOVA. (E) Cell viability after 72 h treatment with 3 mmol/L metformin or 3 mmol/L metformin + 10 μM forskolin (Fsk) in Cal27 cells. Statistical analysis was performed using a t-test.

Article Snippet: For whole-genome screening, the human Brunello whole-genome CRISPR pooled library (RRID:Addgene_73179; gifted by David Root and John Doench) was employed.

Techniques: Genome Wide, CRISPR, Western Blot, Phospho-proteomics, Control

Journal: bioRxiv

Article Title: THOC1 complexes with SIN3A to regulate R-loops and promote glioblastoma progression

doi: 10.1101/2024.09.24.614748

Figure Lengend Snippet: A) Schematic of the whole-genome CRISPR-Cas9 knockout screen in human H4 GBM cells using the Brunello library to identify genes critical for GBM progression. Sequencing at days 0, 14, and 28 highlights top depleted guides as potential oncogenic drivers. B) Identification of THOC1 as a significant hit from the CRISPR screen. C) Pathway enrichment analysis showing THOC1’s involvement in several key pathways identified in the screen. D) Elevated THOC1 RNA expression in GBM compared to non-tumor samples, based on data from the GlioVis portal. E) Increased THOC1 protein expression in GBM tissue compared to normal brain tissue, as shown by Protein Atlas data. F) Western blot analysis showing higher baseline THOC1 expression in GBM patient-derived xenograft (PDX) line (GBM43) compared to a non-cancerous line. G) cBioPortal data indicating a low mutation rate of THOC1 in GBM (approximately 5%). H) Single-cell RNA sequencing data from GBMSeq showing high THOC1 expression localized to the tumor core.

Article Snippet: We initiated the process by infecting H4 human GBM cells with the Brunello whole-genome knockout library (Addgene, Cambridge, MA, USA), which included around 19,000 genes, each with 4 sgRNAs, along with 10,000 sgRNA non-targeting controls.

Techniques: CRISPR, Knock-Out, Sequencing, RNA Expression, Expressing, Western Blot, Derivative Assay, Mutagenesis, RNA Sequencing

Journal: Nature communications

Article Title: CHMP2A regulates tumor sensitivity to natural killer cell-mediated cytotoxicity.

doi: 10.1038/s41467-022-29469-0

Figure Lengend Snippet: Fig. 1 Two cell-type CRISPR/Cas9 screen using NK cell-mediated killing of GSCs. a Schematic of screen design. Screening hits in GSC/NK cell co-culture (n = 2 samples per cell line) were compared with GSC monoculture to identify genes that induce resistance or sensitivity to NK cell killing (created with Biorender.com). b Heatmap of individual and averaged scores of top 25 genes that increase sensitivity or resistance across four GSC models. c GO gene set enrichment analysis of hits. Y axis indicates −log10 FDR of gene set enrichment. d Scatter plot showing the stratification of genes identified by the GSC CRISPR/Cas9 two cell-type screen ordered by score. Highlighted in red are known genes known that typically activate NK cells (MICA, MICB, ULBP1, ULBP2, ULBP3, FAS, TNFRSF10A [TRAIL-R1], TNFRSF10B [TRAIL-R2], and ICAM1; and highlighted in blue are genes are known to inhibit NK cell-mediated activity (HLA-A, HLA-B, HLA-C, HLA-E, TAP1, and TAP2).

Article Snippet: Four sgRNA targeting CHMP2A were obtained from the whole-genome CRISPR library (Addgene #73179) and cloned into the sgRNA-Cas9 lentiviral vector (Addgene #52961). sgRNA#1—AGACGCCAGAGGAGCTACTG, sgRNA#2—CAAACTTGC GCACATAGCGC, sgRNA#3—TCGATGGCACAAGCCATGAA, sgRNA#4—TC TCTAGTTTCTGTCGCTCG.

Techniques: CRISPR, Co-Culture Assay, Activity Assay